breakfast of champions

Joined

• started 139 topics
• posted 5,192 times   see topics posted on
• send a message

Posts by breakfast of champions

• 
  27

  You Are Unsuitable!

  by Divergent in

  1. jw
  2. friends

  today's text -.

  sunday, january 24. they collected the fine ones into containers, but the unsuitable they threw away.—matt.

  13:48.. understanding the lesson of this illustration helps us to avoid being overly distraught or disappointed if a bible student or one of our children does not make the truth his own.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  I've considered myself "unsuitable" ever since I tossed my meeting suit into the Goodwill bin.
• 
  12

  Evolution is a Fact #9 - Less Chewing More Thinking

  by cofty in

  1. watchtower
  2. beliefs

  if you put your fingers on the side of your head, just above your ears, and move your jaw you will be able to feel your temporalis muscles doing their thing.. compared to our primate cousins our temporalis muscles are puny - approximately one eighth the size.

  the reason for the difference is a mutation of the myh16 gene in humans that produces a protein called myosin heavy chain 16. in primates like the gorilla this protein produces the powerful chewing pressure of the jaw.. our closest hominid relative, the chimpanzee have an intact myh16 gene.

  since the rate of mutation can be determined, hansell stedman and his team at the university of pennsylvania have calculated that the mutation that disabled the gene in our line happened between 2.1 and 2.7 million years ago.. the large temporalis muscle has to anchor to very thick and strong skull bones.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Super interesting stuff again COFTY.

  What really fascinates me is how they determine how many years (generations) ago a given mutation occurred. Would love to learn more about that process . . .
• 
  44

  Honeymoon over for the carts

  by Deltawave in

  1. watchtower
  2. beliefs

  speaking with inlaws i another congregation today who said exactly what is being said in our own hall.

  the trolly work is long and boring and no one even notices they are there anymore but walk right on by.

  jehovah really is speeding up the work lol.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  They're going to have to build some kind of hot coffee dispenser off the back of those things.
• 
  52

  The Deep Things of Jehovah(tm). What are they?

  by punkofnice in

  1. watchtower
  2. bible

  i just wondered.

  .

  1. 
  2. 
  3. 
• 

  breakfast of champions

  I agree with everything above.

  Personally, I think it's part of the whole thought reform/brainwashing technique.

  Telling someone that they can't understand something (in this case, pure bullshit) because it's too "deep" for them to understand is really just a subtle way to disparage or attack a person's built-in critical thinking machinery. You don't understand this? Well, there must be something deficient with YOU. No possiblility that this is just total crap and that's why it's incomprehensible.

  It's actually a liberating feeling when you realize that, if you put in the time and effort, you CAN actually understand some truly deep ideas (physics, biology, philosophy, whatever interests you.) Yeah, maybe you'll never know everything, but you can sure as hell rule out garbage like the stuff WT spews out there.
• 
  13

  Snow fall in Jan 2015

  by Lostandfound in

  1. jw
  2. friends

  will the expected heavy snow isolate warwick ny, or brooklyn.

  i hope the snow traps the gb showing clearly jehovah's favour and blessing.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Doesn't look like it. Looks like the worst will be further south, Philly and that area.

  So much for my career in meteorology. . . .

  It's already up to my knees out there and there's no sign of it slowing down.
• 
  3

  Evolution is a Fact #8 - Jumping Genes

  by cofty in

  1. watchtower
  2. beliefs

  we have all become familiar with the use of dna in forensics and paternity disputes.

  all humans share 99.9% of their genome in common, but that still leaves plenty room for variation.. geneticists are able to study sections of dna that identify an individual and their closest relatives.

  mostly these genetic markers are found in our non-coding dna such as the sections of code known as transposons.. one type of transposon is known as the alu element.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  So .. . . . thanks to COFTY'S "Fact #8" post, we have all learned that Jehovah threw some ALU's in our DNA to PROVE that he knew how to cut-and-paste before any of us poor bastards did.

  What COFTY failed to point out is that Jehovah also used "emojis" well before humans did. Consider the gene that codes for STUPID_BLANK_STARE:

  ATTTAGCCCGGATTTAGCCCGGATA : | ATTAGCCGATCGATGATCGAC

  The evidence for God is literally staring you in the face.
• 
  49

  "If I wasn't born a JW, I would never have become one."

  by OneEyedJoe in

  1. jw
  2. experiences

  i've seen it mentioned by a few on the forum that at some point there was a realization that had they not been born a jw, they never would've converted no matter how many times the jws tried to study with them.

  this was my experience too, and i'm wondering how universal it is for those that were born-in but eventually left.

  i think i started having this thought (more specifically that if i were not born a jw, i would surely have become an atheist by now) in my late teens.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  No way in hell.
• 
  10

  Evolution, Critical Thinking, and Other Things the JWs Never Told Me

  by David_Jay in

  1. watchtower
  2. beliefs

  after reading several threads on the topics of evolution and theism, i thought i would share what happens to you when you go to college and get a real education on things: you learn that some of the arguments and stands of jehovah's witnesses are moot to begin with.

  i never double-checked the "modus operandi" about many things, and boy, did i have some real learning to do.. for instance, why are jehovah's witnesses so against evolution?

  it only proves their point.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Great post DAVID JAY!

  Welcome.
• 
  28

  Satanic Temple’s Seven Tenets - Makes 10 Commandments Sound Facile

  by cofty in

  1. watchtower
  2. beliefs

  the so-called 10 commandments are a post-biblical construct.... there is an elohist list at exodus 20 and a yahwist one at exodus 34 that contains such gems as "you shall not cook a kid in its mother’s milk.".

  any intelligent adult could create a more useful list of ethical precepts before the end of a coffee break.. it is interesting to compare the satanic temple's seven tenets.

  i think you might agree that it makes yahweh's rules look like they were written by a bronze age power-hungry, misogynistic priest.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  No wonder this world is such a mess . . . . everyone must be applying these dreadful, Satanic principles in their lives . . . . .
• 
  13

  Snow fall in Jan 2015

  by Lostandfound in

  1. jw
  2. friends

  will the expected heavy snow isolate warwick ny, or brooklyn.

  i hope the snow traps the gb showing clearly jehovah's favour and blessing.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Will the expected heavy snow isolate Warwick NY, or Brooklyn

  Doesn't look like it. Looks like the worst will be further south, Philly and that area.